Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:323C9   

TH:323C9RNAiTH:323C9
PCR_productTH:323C9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y48A6B.6a Source_evidenceePCR826WS150 Sequence/Annotation Release
Y48A6B.6b Source_evidenceePCR826WS150 Sequence/Annotation Release
Overlaps_Gene Y48A6B.6 Source_evidenceePCR826WS150 Sequence/Annotation Release
Chunk_score Abs_score701
Max_abs_score701Y48A6B.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1102193511023554
Overlaps_transcript Y48A6B.6b Source_evidenceePCR826WS150 Sequence/Annotation Release
Y48A6B.6a Source_evidenceePCR826WS150 Sequence/Annotation Release
WB_DNA_textTH:323C91620tcaaacttgtgccccgtagatatcattgaagagttggagtattggagaatcatacccgatcaatatttggcgtcgtgctgttgtgctcagcaaattgtacgttttttttgtaaaggaatgttcgtgtgaaaattagaatttctggtggttttttatattttctgatattttttcaataactgtaaaaatgcacaactttccaaaaaacctgaaaagcacctaccacatttttcaggacgatgacgacgaggaagtcgaagagcaggacaagccgaatttattcaaaactttgagatttggggaaattcgtcgttgcgtttggaatataattgaggagccggctagttcgggaaaagcccaagcttttgcagtttgctccgtggtatttgtgctcatttcgataagcggactcgtgttgggaagcttgcccgagttgcaggtggctacgaaacagaggaacaatttgactggggaaggtatgttggccgtcgctctgggctttcaacttttctttacctgttttacagaattcacggaaatggagcctatgccaattttaggatatatcgaatatgtttgcattgtttggtttactatggagtacggtaaggcaatttcaaattttgtaaaaaaaacgttttggcgggaaattaaaattttccgaataaaaatttagcgcgaaattcaaattttgtgcgacgaactttgcagggaatttaaagttttgtgagaaaacttgtgcgggggattttttggcgggaatttcaattttcgcaaaaaagaaactaggcaaaattcaacttttatgaaaaacatttggcgggaaattcaaatttatgaaaacaattttggcagaaaatttaaattttgcggggaattttttggggcgaaatttaaatttgtggaaaattttaggcgcgaaactcaacgaaaattctagaaaattcaaaaccctgctaaaaatttgtaaatttttggaagacatggcaaatttctaaaagcttcttaaaacagtcaaaaataaaaaattccgtacattgaaaaattgttactgttttttcttcaggcctaaaaatgttggtcagtgctgagaggagcaagacattccggcaactgctcaacatcatagatctacttgctatccttccatttatcatagaaatgcttctcttaatttttggaatatcaacggagcaactacgggacctcaaaggagcattccttgttattcgaattcttcgagtgctcagagtcattcgtgtgctcaagttgggacgatattccagtggtctgcaaatgttcggaaaaactttgaaagtaggtccaagttttgatttcgcgccaaaattttttgaaagaaaaatggctttttgactccgcccctttattggcaattttcaggcgtcattccgtcaactgggtatgatggcaatggttgtaatgacaggtgtcatatttttctcgactttggtatattttttggaaaaagacgagcccgcttcaaaattccattcaattccggcggcgtgttggtggtaagacactttttttccaaaaatatttgaaattttttgaaaaaaaactgatatttaggtgtattgtcaccatgacaacagtcgg