Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:323G10   

TH:323G10RNAiTH:323G10
PCR_productTH:323G10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC47.3 Source_evidenceePCR897WS150 Sequence/Annotation Release
Overlaps_Gene ZC47.3 Source_evidenceePCR897WS150 Sequence/Annotation Release
Chunk_score Abs_score813
Max_abs_score813ZC47.3
Specificity_index0.92
Rel_score1
Map_statusUnique_ePCRIII12721631273648
ZC47.5 Chunk_score Abs_score71
Specificity_index0.08
Rel_score0.087
Overlaps_transcriptZC47.3 Source_evidenceePCR897WS150 Sequence/Annotation Release
WB_DNA_textTH:323G101486tccggttgaaatgctcttgcaagttcaacaggcttcaagttttgtattagaattaaaaatgtgcatttctggaacgtacttctttgcaacagatcctgaaaattatttctggggtataaaacatattatcacagttataacttacatctcgaactttaatcgcactttgtattggaaattcaggagcattaatgaaatttagattttcattgacaattggttcatcgtaactgttgctctttacacgaaaagtgctgaaattcaattaatttctatttcagcttgattggtacaatattttccagaaatcgatgctttatacataaggaaatataaaaatgacaatagaaaataatacgaaacacaaatcgttagcattttttgatttcaaacttccaagcgcgcctttctttgggacaatctccaaagtttatttcaaatttggattttccgtttgaataatccagtttaaacgcatcaccaccagtataatccggttggaatgttcttgcaatttcgacaggcttcacactaaatttttcaaccgaaactgtgcattttttaaacgtacatctttgcagcagatcctgaaaattaatttaattataaagcttattatcaaagttataacttacatctcgaactttaatcacactttgcattggaaatttatcagttttaatactaaactcttcaaaatgaaagagatgtacaatgtattcacaattaaacgggaaaagttgaaaactgaattttttcgcgttcttccattgatccaaactagttattttcttgaattggtcaatttcgaaagattcccacaatgaaatctctcgtagcgttttagcatttagtaacggaaggattgttaaaaccttatctaatgggataaaagtcagggctatagtttccacgtggatattcacatcttccttcaggatatctacaagtaagctgacaatgttttctctatctcttgttttgctggaaatgtataacttagatgtatgtttcagaagtatcttcaggtccttgaaagctgcttccatacagtttacaccttctatggttttgttttgcctattgctttgcatatatgatctaccattcattgttacagagtagatgatttcaatttcgtcgaaatatatcgaaacgtagcagttgcacaattcaattgagattttgttgaaatgaacgttttcatcaattgcactccgtaaacttcgacatactttccgggagattagtctgaaacgggatatatttaattttaagggtaatttgacaccactttttgctcaagattttttcagccattgattggtttataaaacaagttagtacattttttaatgaactgaaagtgtttatatttttcgaaaagttgtttaataatatcgattttgacaagaacttacaattccacgggttctagtttttccagaatttcattcgcaatttttatgggcaaatcaagcaaagt