Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:324G4   

TH:324G4RNAiTH:324G4
PCR_productTH:324G4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y48A6B.9 Source_evidenceePCR601WS150 Sequence/Annotation Release
Chunk_score Abs_score496
Max_abs_score496Y48A6B.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1103313811034758
Overlaps_transcript Y48A6B.9.1 Source_evidenceePCR601WS150 Sequence/Annotation Release
Y48A6B.9.2 Source_evidenceePCR601WS150 Sequence/Annotation Release
WB_DNA_textTH:324G41621ccgaaaattcggagatcctctcaaagttctgcagttggaaactgtcgaagttcccgccgagccgggcagtggagagtgtctggtagagtggttggcttctcctattaacccattggatattaatcggtaattgatatatttttgtgaatataaggatttgaaaatattgaaggatccaaggaaactacgcggtcagagccgagctaccggtgatcggaggcagtgaaggtgtcggcagggttgtcaaggtatttttttgttggtttttttggtactaaaatgtttgaaaattctagacttaggcttaggcttaggctcaggcttaggctttggctttggcgtagacttaaacttaattccctatcagaattaaatgaaaaatgttaattttgagtaagaagcttgttttttttttaattgaaaagttcttgaaggctggctcgggctcccgcttcaaatctggagaccatgtgacaatattctcagcgaatacacctatttggacggaattcggagtagttgatgacgatgagctagtcaaattggataatagaattcctttggtatggttttatgtggccgtggaaaagagaaacctctgccacccttgaaattctttttaaaaaatgtagaaaaatcgaataaaaaatattttcggataaggacattttttaaaattaaaaaaatcccaaaaaaatgttcctggagtaaaaaattttttttttcgggaaatctgaaattttgaatgattcatttttgaaaatttttatttaaaaaattctcacaaaatttttaattattttcaaaattttatagttaactgactaagtttttgccaacaaaaagcccaaaaaaatcacaattttagaaaaaagttgagtttttttttctaaaataaaaatttaaagaaaaaaccaaaataaatttttttgaaaactcaaaaatcttccgaaacccccctggaacaaactatgtattacagaaacacaaaattatgagaatgcgtattgcacaacatatttgacgcgcaaaatatctcgtagcgagaactacagtaattcttgaaatgactactgtaatcctggtgatttacgggaatgaatttattttcgaatttttcctaaatttccatattccatcgataaataaatgatttaattttttttttcgaaaatcatgcccgtaaatcgacacaatctatagttttcgctacgagatatattgcgcgtcaaatatgttgcgcagtacgcattctcagaatttagtgctcccgtaataaattgatactttaaaaagttaagaatttgcgtggccgaaaattttctcttccatggccccaatttccaggatctcgccgcaactctcatgataaatccgccgacagcatggattatgctcaaaaaatacgtgaatcttcaaaaaggcgattatattattcaaaattctgcaaattccggtgtcggtagaagtgttatcgaaatgtgcaaagcattaggctataaaagtattaatatcgtcagaaatcggcagaatattgaagctttgaagacagatttatggaggattggagcagatcacgtgtttactgaagaagagttcaagggcacttctaggcaggtga