Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:324G9   

TH:324G9RNAiTH:324G9
PCR_productTH:324G9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS K01G5.1 Source_evidenceePCR758WS150 Sequence/Annotation Release
K01G5.10 Source_evidenceePCR619WS150 Sequence/Annotation Release
Overlaps_Gene K01G5.1 Source_evidenceePCR763WS150 Sequence/Annotation Release
Chunk_score Abs_score721
Max_abs_score721K01G5.1
Specificity_index0.565
Rel_score1
Map_statusBest_ePCRIII1075669410758267
K01G5.10 (3)
Overlaps_transcript K01G5.1 Source_evidenceePCR763WS150 Sequence/Annotation Release
K01G5.10 Source_evidenceePCR619WS150 Sequence/Annotation Release
WB_DNA_textTH:324G91574acgatcggatcaacaaatggatttccgcaaataaaacaatcctccggaaacgtatcgtcgccttcatgaatctcgtaattcgcatcgtcttcagcaccatattttcctgcttcgtactcctcatcaatctcccatccgtgtttatagtccgatcggtcgtgcacaaatttacacgaatctccaaacgtacagaatccagtctccttgtaatccttgcaaatatccggtgcaaaatcccaacggactgtttgtcgtagaaattgtggcgcccgaacgggcccaactcgattataaccacttgcagcgtttcccttggccgtatccttcgcctctttggctccatacagtgcacttcccttgtacagaatttttccgtctttctcgacgccttccttcagttgctgttggactcgttcgaattgagcctgggcatcgtgtgaatagtctgtgtccacttcgagtgttgcagtggcaccttgatcacgtggtccagatggaccggcatctcctgaagcggcgaacgagtgagttgctactgcgatatcctgattgtcgtcagagtcgtcagaatcatccgatgaattatcagcacgtcgtgttgaggcgtctagttgtttggtctgaatttcaaagtttattgggattttccaaaattttggagcactaaagtaccaagatctcaccgactggaccatcggattcgtacgacgtcgcttttgaatcacatccttcacttctgaatcttgatcctcatcacttgagctttcctttttacgaacgacgggtgcattgcgctttttcggttttcggaagagatccattatctgaaaaattaaaactatttattaaattcaattaattaataaagcttcaaatctgacaaacgagaaatacaataaaacggttcaacattatgagaggaagatgaatcaaacaatagagctctacagccgaaatttttggcgccatggaaatcatttttcaaattgtctccaatgtgcaagatttccgagggagaaattagatcgaaatggttgacaactagctggaagatcttctcatcgggcttttcgtacccaatttcgccggagagaactgtcatggagaaaagatcgagtaaattgaattgagaaagtagagatttcaagcgactatcgaaattggagatgacaaccaggatgattcctttcaggcgaagtttttgcagagtttggcgcgtctaaaatgaaaaattgcagtatttttttttcaacaattcacaaaatttacatcgctttcaactagtttccacggctcaggagttgcatagtgattgtacaaagctccagcgatcacttcaacccgtcctttttcagaatccggagcacactgaaactatcaagtaggggacttgcctaattcagattacacctacatccaaaagcgtagaagaaactacttcaatccaccaacttttgtttccaattccattgaacccaaagcagggcgatgcgatgctcattcgtttataatttttaagaaagcttcccatgatttgatcggagtcgacttccaaatcatattgcctcgcgaaa