Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:324H9   

TH:324H9RNAiTH:324H9
PCR_productTH:324H9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK03H1.12 Source_evidenceePCR339WS150 Sequence/Annotation Release
Overlaps_Gene K03H1.12 Source_evidenceePCR370WS150 Sequence/Annotation Release
Chunk_score Abs_score307
Max_abs_score307K03H1.12
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII99417099942390
Overlaps_transcriptK03H1.12 Source_evidenceePCR370WS150 Sequence/Annotation Release
WB_DNA_textTH:324H9682tgtcaaaggagacggttcggcgccaccaccaatggcaaatgctgtgtcggctccgtccccagtagctgctcggacaccaccgacgtttgtgaacgttccaccaccaccggcaggaatccagaaggacagaagtgtttccaaaaagtaagtgagaagaatttgattagtttacatcaatatagtataacctataaatatatttttgcagtgacaccactcctgaaccaaaagcgagtacaaaggacgcatcatccgtgcttatggatccagagaatgagaacaaaagcggctcttcaaaattgccacttgtggtactcaaacctttcaaaaaccaaaagctaataatttaatttcagattcgaattcttctcacaatcaacactatcctgttcctgatcgttctcgtcttctggttcttgacactcttcactggactccatttgatcaatatctccttcattaacaatatgtttaagtgaactcttcaataaattgtgatttatggaaataaagttcttaactttcccccaacatgtatttacagttttccaagattctttgaaacgaaaataaaattaaaacagctcgaaaatgtatcacatgttaaattacatagatgctgataccatgacggcagattttactccgggcgagaagagggcagagatgaggctggcgagta