Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:325A7   

TH:325A7RNAiTH:325A7
PCR_productTH:325A7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54C8.6 Source_evidenceePCR591WS150 Sequence/Annotation Release
Overlaps_Gene F54C8.6 Source_evidenceePCR591WS150 Sequence/Annotation Release
Chunk_score Abs_score508
Max_abs_score508F54C8.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII94448379446463
Overlaps_transcriptF54C8.6 Source_evidenceePCR591WS150 Sequence/Annotation Release
WB_DNA_textTH:325A71627catgccaaattgcagtgaacaaagttccaaacacagtgaaaccttttgaaattgtttggaagaattcggagattgctgaaaatgccatgagattactgtaaacgaaataaaatctaacttacttataaacatttcatcaagcaatccactcataacttttggtaactcttcagacaaaacatatggatccggctcacaaagagcatcaaacaatggtgagaatggtccggagaagtatctacagaagaatgatggttgtgtagaaacaccacgcaaaagtttgataaaggaaataaatgtgattccgaagaagaaaattgcaaagcccagaaggacactcgggaagtattcactgaaaattattagaataaattattggaatttaacttttttggaatgaacaaatgttttgaaagtatattaattattatagattttgtctattattagtgtagggggttcaaataggcaactttgcccaaacaatttccaaaaggcgaaatcttccaaaaattttagcaaattacgaatacgttaactgaatatgtttaaaaaaatatctgacaaaaatgttgagctttttattatgggatttggtcatgtgtacttaacaccgttctgcatattaatgactattttttctagagagcacccatatcagaagggaacccaaatgtttttataatttggcaaattaccaaaaatgtgactggaagcattaacaaaattttgaacaatattcgaggtttcaaaatcatgatattttagatattttggactgttttgagtcaaattgttaatgacagcattttaagagctcccaacacatagtgtttccaatgttatacccaatcaataatagcaagtcaataaactacctctacactatttctggtaataggcgaaacctctacactgtcagtcactttgtaaggtgtgcctatgtatttccataatatttcatacaaattgttcttccgagaacatatactaaaattggaacaatacagagaagattagcatggcccctgcgcaaggatgacacgcaaattcgtgaagcgttccaaattttttgactaatttctggtattattgtttagaattgtaagaaaattttacattccagaaaatgtatccaaaaaacttacgcaaactcggagcgtatagttgcatgaagtgctggatccgaaatacgaacgacaaattgttgatactttgctttcaaactctcgtaataaggcatcacaaagttctcaattttcttgcaagtagtacaatccgatggtttttcctccttcacttcgtcctcatttggagccagaatttcaatttcttgcacaactgagctagagggtgtaggctctgggagcccatttgttgggatttcgaccacttttggtgcttcctgtaatacataaattagttaggaagatgaatacagtttaggaatattgtatttataacaacgaaatatattttaatttatatttaattcaaaaaatttgagctttattaatttgagagttgaattaataaacaaagttacaaaaaattcgttgctatatttttttacttgaaaaatatagttttgacatacttgaatagttacagttggaacgagaaccat