Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:325D12   

TH:325D12RNAiTH:325D12
PCR_productTH:325D12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF34D10.3 Source_evidenceePCR444WS150 Sequence/Annotation Release
Overlaps_Gene F34D10.2 Source_evidenceePCR21WS150 Sequence/Annotation Release
F34D10.3 Source_evidenceePCR477WS150 Sequence/Annotation Release
Chunk_score Abs_score414
Max_abs_score414F34D10.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII37341483734869
Overlaps_transcript F34D10.2.2 Source_evidenceePCR21WS150 Sequence/Annotation Release
F34D10.2.1 Source_evidenceePCR21WS150 Sequence/Annotation Release
F34D10.3 Source_evidenceePCR477WS150 Sequence/Annotation Release
WB_DNA_textTH:325D12722aatgctctcacagcaaccgcgctctctcgtacgcttctctttctctgcaccctccccctcttattgtctccatcgactatttttctcaatattatgtgaataaaattgagttcatttatgaatatgcgacttttatcgggtcaaaaagcgatctgtgtcttccttgaccttcttgccaccacgatttgtttggctctgtttttggtgagcagaaatgaaagataaattgaaatattttcaataaaccggagacaataattccaggataattcaagtggcgacaaacagtacattttcctttgtcttatagtttttgccacagacgctgcgtgcttcggagtgctcttttacaacatttactccgaattacgcacaaatggacagcaaaacctcggaatccgcgctttctggaactttttgtatccattcaataatgtttacacaggacagttcggttagtacgaaaataaatatattttttgaataaaaaaaatcgattttcagtatgcatcacttgcaaagtggttttcgaggttctcatcgcaattcggctgacatttgcactttcaattccatatattgtctatttcatcccattttggatcttttgtggaataatttttgtcgatctcacgcggagactttactccgttcaaaagaaaataaataatcattgatttataaataaattgcattattaccgtcaaaatcatcgtcgtgca