Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:325D4   

TH:325D4RNAiTH:325D4
PCR_productTH:325D4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY48A6C.3 Source_evidenceePCR755WS150 Sequence/Annotation Release
Overlaps_Gene Y48A6C.3 Source_evidenceePCR755WS150 Sequence/Annotation Release
Chunk_score Abs_score692
Max_abs_score692Y48A6C.3
Specificity_index0.531
Rel_score1
Map_statusUnique_ePCRIII1111705711118745
Y48A6C.1 Chunk_score Abs_score612
Specificity_index0.469
Rel_score0.884
Overlaps_transcriptY48A6C.3 Source_evidenceePCR755WS150 Sequence/Annotation Release
WB_DNA_textTH:325D41689gaaagtgcaaacggaaaaatgagacacagaaaataaaatggaaataaaagaaggatcaaattgagcacaagtcaagggcgtcggcgagcaactctttctcgatatcgttcgacgggtccattttgagtgcgagctgaaacattccaatggcggcttctttgttttcattgtaaagaagcgctttgcccaggtgtacaatattatcgatccaatacggtatgagatcgaaagcggatctgaactgataaatggcatcgtcgatagcgtcatatggggtggcataatgatgaattaactgttgtcggtcagactcccaaatctccagtgctgaaagagcccaacggccaagaatattattgtacattgcattttttcctgcctggatagagatggcacgatcgagatattgtctgcagtgtctcatctccagattcttttcatcgccttcaagatattcgattgcctttcctgacatcacagcggcccaatgagcagccaagatgttgtacgaatcggtgttccaggcttcggtagcgtacatctttcctttgattatgatgtcctttctcttttccttctcaacaaaatttccaatttttgtacacaattttgccaaacgacagagaagatcgatggacttctctccagaatcgtatctctgcaaatttcgaattttatttcattgtttaaatacaaatgaatagtctaccatctttaaagcttcaaaacagtcgatatagaagtcacgagtaatcattggagaatcaacgacagcaatctgaaatcgaataatttttcgttaaaaagagtatcaaaattttaaaactgtcacatcaaatttgaatttagccaagcccgtgaaaaattccctctcgatttcggatgccaaaaattggctcgaatcgagagatattcgggagatgctggaatcaaataagacctactttcttttagatttccgccgatcaccacaaaaatgaaaagagtgggtaatacatggcggccgacaacccacgggttccgcgcctcgctctaaattaagtcaattaagccacaccctatcagttggtgtgcttttgaagggcgtggcttaatttacttaatttatagcgaggcgcggaacccgtgggttgtcggccgcgatatattacccactcttttcatttttgtggtgatcggcggaaatctaaaagaaagtaggtcttatttgattccagcatctcccgaatatctctcgattcgagccaattttcggcatccgaaatcgagcggagtttttcgcgggcttggctggattcaaatttaaggtgacagttttaatattttacttttaatataatacttaactgtataaaaaacctgaactgcctactgtagaactggcgtcgatgtattggcttgctatttgtaattttctgatcaaattgtgacagcgaaattcaagttgttgtcatttttgtgatttcttttaatttttatcgaatgatttccgtaagtcgccgctagtgatacagtagtctttgaaaaagttactgtagttttcgatacaagatattttgcgcaaaacgcattctcagataaaataaaattatcatctgctccttaccagcttttccgtgctcgtgtttccccaatgacgaataaccgctcgcatgatcactgaattgaattcttcaatcacatcaccgg