Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:326B11   

TH:326B11RNAiTH:326B11
PCR_productTH:326B11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST24C4.7 Source_evidenceePCR814WS150 Sequence/Annotation Release
Overlaps_Gene T24C4.7 Source_evidenceePCR814WS150 Sequence/Annotation Release
Chunk_score Abs_score793
Max_abs_score793T24C4.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII893192894385
Overlaps_transcriptT24C4.7 Source_evidenceePCR814WS150 Sequence/Annotation Release
WB_DNA_textTH:326B111194tttttgcttcgccaaagacgaaatatgaaagatcagaaaatgttcggttttttatgatttttttgttgagaaatctgaatttttaatttacaaaatgttccgttcttcgaaatataaattttcgaattacttacaaagacttttcttccaggttcaaaactagtgttcaatcgattctcaacaccttcctcttcatttctcaattctgaatgataagaaatatacttgtcgtgaatgatttcttgattatctccattatgatataaattaggagcttttctattgaacattcgttcgaatggcgtctccattcgatcaggaatcggtttctgattatattccattacgagaaattgcaattgttctacccatcggtttcgtgttccaagctcattttgagctagttccagaacccatcgttctagacaattatacggaagcggttcattccaaacttctcgaatttccacagcatacacactttccaatgattttattgtatcccggatgtatgtcggcgagaatgatgttgaaaatccctccggaacaccgtattcattaaaaatcgagttcaaaattcgtccgatcgctgttcttgtgcactcgaaaagtggtttcgcccacaaaaatcgtgttttcagacaagtgacgatgagaatgttgtcgtatattttgtttccataaattgaagttggcatctcatgaacatcgatttgaacatattgcattggatgattagcccaacatgctggtttaatggggaacactatatccattggtctagcattatctgcattgctattctgagattctgtgtcaggagcatgaccgatgtgatagagctgcatgaacgtatgtacttcaccgctggaggattcgacacggtatgagatgactgaggggcacgctgatccttctttcaacattctttcacgtgggagtcggtgtctggaagaagagacattataggtggagtaccgaaatagttttagtttgaaactggctcgaaagttgtctgaaattccgttttgggcctataactagaacaagaactaaaaaattcgttactcatttaaaggtggagtaccgaaatctgagactgcttttttagagccaaaatggtccaaaattatcaaatttcgcaatgagacgctctgaaaatgttttttttaagttacggccgcttaaagtttt