Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:326E12   

TH:326E12RNAiTH:326E12
PCR_productTH:326E12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC29F9.11 Source_evidenceePCR823WS150 Sequence/Annotation Release
Overlaps_Gene C29F9.11 Source_evidenceePCR823WS150 Sequence/Annotation Release
Chunk_score Abs_score760
Max_abs_score760C29F9.11
Specificity_index0.46
Rel_score1
Map_statusUnique_ePCRIII109247110466
C29F9.10 Chunk_score Abs_score162
Specificity_index0.098
Rel_score0.213
T12B5.10 Chunk_score Abs_score142
Specificity_index0.086
Rel_score0.187
T12B5.6 Chunk_score Abs_score129
Specificity_index0.078
Rel_score0.17
T12B5.8 Chunk_score Abs_score225
Specificity_index0.136
Rel_score0.296
T12B5.7 Chunk_score Abs_score233
Specificity_index0.141
Rel_score0.307
Overlaps_transcriptC29F9.11 Source_evidenceePCR823WS150 Sequence/Annotation Release
WB_DNA_textTH:326E121220aaaatcgcggaaaacaaatttttcagactgtttcacatacaatcaaactgacagaatcagatgggaatggattttcacaatcttctcacattcaattgaaaatgatttgaattaaacttccaaagcgaaatatcgaatgtgtcgttaccatttggaaattcaatcttaaatacgtttccaccagtgtagtccggtttgaatacttttgcaatttcaatcggatttgactttgaatttgccaattttaaatcgcaactttggaatgtacttcttcttaaaagatcctgaagaaaaattaattgaatgaaaaacagggttatcttacatctctcatttgtattgcagcctgtgctggaaattcgtcagtgtagtcaacagtgaaacatttgaaatgaaaaaaatgaacaatcattgtactggcaatcttagaaccatcaattttaactacttctgcatttttccattgctccaattgggttatacgttcaaaacggtctattgacttcattgactccatacatattaatttaatagttttgagctctttagcatcaaaccatgaaagaatcgtaaggacttcatcaaaaccgaaaaaccaaagttctatttcttttacatgaatacatttttcggctttgaaaatcttaatgaaagttgtaacaatgtcgcatctatttcccgaatagttcgaaattacaattttccctgcgtgcttcgataatatcttaaaatccttggccgctttttccacaaagttttctccatcaatcaactttgtctgttcattgtgaattacaatcgaactcgaactgccatttgctgcagtattaaatatctcgactttatctttccacaagcgtaacctgatgcaatcaaaacgtaatccaaatttatcgacagcagttctcaaactgcgacagacttttctcgctctcagtctgtaataaataaatcttatttgggtgtggctatgaagttactttttagaaaatctcctctattgatattttagcttggaatgcaaaataagccttttttgaaatcggaatgaatagaattgtgccaaagaacaaatatttcttaaattctgcgcagcacatttaatgtttaattgtacttttacaaaggactagcgggccctgcgggcccgccagttgtagggggtgtaaggcgagtccccttgccgggcgtaggttctcggcttcgcctcgaacctgtta