Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:327E5   

TH:327E5RNAiTH:327E5
PCR_productTH:327E5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS H19M22.3a Source_evidenceePCR879WS150 Sequence/Annotation Release
H19M22.3c Source_evidenceePCR777WS150 Sequence/Annotation Release
Overlaps_Gene (5)
Overlaps_transcript H19M22.3c Source_evidenceePCR777WS150 Sequence/Annotation Release
H19M22.3a Source_evidenceePCR879WS150 Sequence/Annotation Release
H19M22.3b Source_evidenceePCR227WS150 Sequence/Annotation Release
WB_DNA_textTH:327E51214atccgtgacgcttaaatggtatatctccgactacaccagcgatatcgatcgtctcgagacccggaaagttgtcgagaaggcgttcaagctgtggagctcgcagagttatatcaagaatgagaagaaggtcacgttgacgttccaggaagcatcgtcgaaggatgaagccgatattaatattctatgggccgaggggaatcatggtgatgagcatgatgtaggttttttttttggaaatttaagtcggagaaaaaaattctgaaatgttttgaaaagaaaaaaatctagcagattgcaaaatctaggtgatcatcgtggtgagacccatcgtggtgagacccatcgtggtgagacccatatattttgcaaaaaaaattgtatagaggagaaccctggccaaaagctagatcaattcttaataaaaaaaaccttgcagtttgacggagccaatggaaaaatcgagggaaacaagaaggaaaatgtgctcgcgcataccttcttccccggctacgctcgcccattaaacggagacattcactttgacgatgccgaagactgggaaatcgatgtggatcaggttggacacggaagcaataaacgatttttcccatatgtcctggctcacgaaatcggacatgctctgggcctcgatcactcgcagaaggccgacgctctaatgcatccgtattacaagaacgttccgatcaacgagatccagttggacattgatgataagtgtggagtgatctggaattacggtggagcatccgacttttgcctgtacgtctggcttatgagccagatcgtcgaggcacacaacagctcggcacagaataatcgtaagtgtgcagtgagcagctgctgcgacaaggtcaagctctagattgatgaatttcagatggagtcggctcgattaccagctcgaggaccaacaagaaatcttttaaaagtgagggtttctttctttttcaattaaaatttcctcattccacactcacacacacggatgacgttgtgatgcgcgaaaaagataaaagatcgtatcgtgggggtatttgtcaagttgggaaagtctcgaaaattgaaaactaaaccatttaacttttagactcaaagattccaaagtgctcatcgaataactcaagtcaacggacgcttgccgagaagaagctcacactcggcttgcatttgagtgaagccgatgcaaaacgata