Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:327E6   

TH:327E6RNAiTH:327E6
PCR_productTH:327E6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSM01E10.3 Source_evidenceePCR438WS150 Sequence/Annotation Release
Overlaps_Gene M01E10.3 (2)
Overlaps_transcriptM01E10.3 Source_evidenceePCR438WS150 Sequence/Annotation Release
WB_DNA_textTH:327E6997ccagatccgcagtgcatagcacttgaagaacggatcgtcctttaatcctttttttttaagccgaattagccgaaaattagccgatttgactgactgacattagccaaatcagccgttagccggttctcaaaaaatcggcgttagccgatttatccgttagccgaaaaaatcggttatccgcacgcacctggtcggtaccgatgccgaaagtggtcgtcgctgcagagagcgacacatcggtgccgatgcggctagagtctgtgccgatgcgacaaaaatgtatctttctctgaacctctcgctttctaccgtgtgtcctccacatcactctttcctttgaaccgtgcctttctcgagatccgaacttatccacgttgatcatcttctgtttactaatccatccttttacctgtagatccatccgcgcacgcgcgatgctaggtttaactcagattaaaaggaaagatgctgcgccgttttagacatatgtgatgctgctcgtgaatatgactttacagttatgaaaaaaaaaagaacatatgcagtatggaagcttttgaaaagagtatcacgtgttcgtatcacatgcgagattattttccaaacccatttatttgaagtggaacactaatcattgaaattttaaaaattttaaaataaacagcttaataagatatcagtatattcagtgtaccatatgttatctcattcatattcatattcatattcatatctcatattagttcatttaaaaagagccgaacaattagtcttgtatgcagcactaatggagaatatacggtaccttatttccacaattatttttgcatgcaaaactaaatttcgaagtctcgtaactttgaaaaagtgaccaactattatagaaaattcaattttatactccttaaacaatgaaaatacatacttttccaatactttatcaattatttgtaagtatgttccctaaattttatatttagcaggaaattattggttt