Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:329F9   

TH:329F9RNAiTH:329F9
PCR_productTH:329F9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T07C4.1 Source_evidenceePCR77WS150 Sequence/Annotation Release
Chunk_score Abs_score77
Specificity_index0.116
Rel_score0.169
T07C4.3 Source_evidenceePCR152WS150 Sequence/Annotation Release
Chunk_score Abs_score131
Specificity_index0.197
Rel_score0.287
Map_statusBottom50_percentile_ePCRIII1035482810355761
T07C4.4 Source_evidenceePCR498WS150 Sequence/Annotation Release
Chunk_score Abs_score456
Max_abs_score456T07C4.4
Specificity_index0.687
Rel_score1
Map_statusBest_ePCRIII1035482810355761
Overlaps_transcript (4)
WB_DNA_textTH:329F9934ccttctaccgtgtgtggttttctagtttacgtgttctcagggtagctgagaacttttcccccattcaacaactagaaccaacacgagttctaattttaataactctaaaattccacgcgcacaaaccaatttcgccgttgtttctgtttttgttaaatgaaagaatattttgatgattttgaaggaaacatttattattcttagcacaaatcaacatccttgcacgccttgtctggagaatccttgttctcaatatcctttttcagctccttcttgaccttcttcagctcttcctcacactcgtgatgcaacggcaacagcatagtccagcaaagagttccgatgttcacatcaagccatgcatcgagatcatcatctccaaccttctctccaccctgaaatatgtgaataacgaggaaaattggagatatttggagcacaaacctcgacgagagccttgcagacatcacagaaaacaccgtgatgcttcttgagattgagtgggttagctggattggctagaagtggagcagcggcgagcaagacaaggaaaagacacggaagaatgcgagtcattctgtagattttaagatgaaaaactggagaaatgaagcgaaaatgcacccggagcagtgatgctcgtgtcttttatcaacttcgcggcggcactgataaggaatcgaatcgtttctgatgttttcagcatggaggaaaagatcaaaggacattatagaatacacaccgggtcgttcacacatcagatgccgatttttcgaactgataagatcgcttagaggagtagcttttcgccttgacggagaaaatattgattaatcaggttagcagtaaagtaaatggtgtgggcatgtgatttcttgataatttgaggaagatggaggcaatcaatttacttatttcaacaattctggggaag