Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:330D11   

TH:330D11RNAiTH:330D11
PCR_productTH:330D11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F45G2.8 Source_evidenceePCR341WS150 Sequence/Annotation Release
Chunk_score Abs_score271
Max_abs_score271F45G2.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1343460713435174
Overlaps_transcript F45G2.8.1 Source_evidenceePCR341WS150 Sequence/Annotation Release
F45G2.8.2 Source_evidenceePCR341WS150 Sequence/Annotation Release
WB_DNA_textTH:330D11568cgtctatccgctcttttgcacggaatacctggaatgaatacaggttaaattataattcaatagactttctcactttgctctgcaaatacaaagttcctcctttcgatttatcgttgatattgaacaagtgttcgtagtgtttttcgacttcttctcgattcaatggagttttcacgttcagaatttgcaaggattcctggaaatttttatttttaatcattaatttgaagagctttgagttttctacaacttacctctaatgagatacccaattttgcattagaattcgcattttctcttgtttcacttgcagattgtccagtggaggcggcgtgacgagcagcagcttgttgggtttctgaaaaaatgttaatttatattttttgaataattttcgacaacttgcgacaattttggacaactttcgacaactttcgataattttcgacaattttcgattggtttatctgcaaaaaactcacgtttgatctcatctcttacggctcttgtgagcgcttttgcgactgcttctccagcggcaagagccactttcagtgcagttctccac