Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:330G12   

TH:330G12RNAiTH:330G12
PCR_productTH:330G12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS T04C9.4a Source_evidenceePCR115WS150 Sequence/Annotation Release
T04C9.4b Source_evidenceePCR115WS150 Sequence/Annotation Release
T04C9.4c Source_evidenceePCR319WS150 Sequence/Annotation Release
Overlaps_Gene T04C9.4 Source_evidenceePCR319WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII59727605975131
Overlaps_transcript T04C9.4a Source_evidenceePCR115WS150 Sequence/Annotation Release
T04C9.4b Source_evidenceePCR115WS150 Sequence/Annotation Release
T04C9.4c Source_evidenceePCR319WS150 Sequence/Annotation Release
WB_DNA_textTH:330G122372cattgagcagggaatttgcggaggaattaacgttattaaaacacataaacatgttttaaaacatgaaacattgactaacgtcatatcaacttcagtatttccaaattgttctccagtatccattgtcaatgatccggcgccgattccgaaaccgattccctgtaattataattgaatttagccagctttatgctattttttctttttttcataaaatcttccgaaaattgcaaaaaatgtatttcaaaatttcgagacttgccaaatctctattctaactaatatgtttgaaatgttgagcaacgtttaatttaaatctcgaaaagtcttgtggctcttcgattttctccaattaacattttaattgtgatgtaaaatgcgttaatataacacgacatctgagttcatttcaaagtgtaaaaaaatatgcggtaggcaggcctaggcctaactattttagctttaatttccaattaataaattgcatacctttggcccatatcgcctgcaatgacactgcttacagaagagttgtgcttgatgttcacagcatgacattgaatccaataatttgttacacatacctgaataggacaaaaacacattaaaagacaagacgaatacaaggacgagttaacatgaagcatttggggggaatagggaatcacagaaccattatttcttattcactaagagattctattaaattattaaattctttaaaactcactgcacttgaagcagaacttgtgccatttgtatccgccggcggacatctcctctgcggcgtacacacttttgccgcacttcgggcattttgggtgctccacaggcttgaatggcattctggaattaatttatcttaaagttgggaaacatcaaaggtgaaaacattttgaaattaaactcaaacagaaaccaaaagtaaatacgaagaaactttgaaaatggtgtgggcgggatctgtaaggtgactcaatgggcgggacttgaggggtttcgtcattctgttacaattattaggatgatggaaaaaaaagtttgaaatctgggagacacctggcgctgtgggctttcaacacatttcaagagcgacgtggcaaacattaagggaattgttcgtttgaaaaagaaatgtaaaaatgttaacaacttttgggtttatccaaaatttacagcaactttttttgaaatctgcaattgtctgagaataaaccagaaaatacaaattgttgaataactttctcaaaaaatttgaaagctttaaaaatttcaaatctaaaatattagtgaaaattttcagattttccaaataagctggtttttagaactgaaacttagacggacaacaattttgtttcttaattgtagtaaaataatcttaaaaacaaatctaaaattataaaaattcaaaaactatatattttgatttttaccaaaacttgaacaattttttgagactataaataggttttctataaatctgaaactcgtgatgaagaaaaattttttttttaatttccgaattattataaattttttcgaaacattttcctaaattcctaattttccaaaactaatttaatcttttgaaacttgaaacaaacaagacaacctatttttcaagtttatttgaaagaatttcaaagaaatattagtgctcaccgagcccgtaggtgaaacaagcttacaaataatgcctatttgctctatttattatttcagaaagtgggagagagctctctctcggaagattgtagtagccagagaaaagaggaaaaagcaaagaaatacaatgtaccgcccatgtttcggtacgttttaatcatcgaaaagcacaacaaaacattgtattgtttctgtcgggagaagagcattcatggaaaagaaaaaaacggaaaaatattttttgaagaaaaatatatattgaaaacaataaaatgaaattgtttttgttccaaaaaagaaggaaaatgtcaaaaaggaaaaaaatttggatgacgaattggggaaaagttgaacatgaaaaacgtttttttttggattttttctgggagatattagaaattctgattttcaagaatacttttcatttatttcaagaagtggaacttggtttgcaacctgtattttaattttgcaattttttttcaatccggtctgttttggtctaactagaagtagttagagtaatcacctaccaaaataattttgaaagaagacgaatccctatgaaaatctgaaaaaatattttctgaagatcagtggccacagttgaacaattttttatagtttttttttctgcagtagtgttttcaatgaaatctttactacattttcagccgcaaaaattttcgatcaggctggatttt