Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:331D6   

TH:331D6RNAiTH:331D6
PCR_productTH:331D6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y49E10.20 Source_evidenceePCR1015WS150 Sequence/Annotation Release
Chunk_score Abs_score912
Max_abs_score912Y49E10.20
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1245390012455441
Overlaps_transcript (2)
WB_DNA_textTH:331D61542aaggactggaacaacgacgtttgtcgtgttttcggtgacactgaaaaatcgataattattagagatttcaatttcgtaataggtaaacctcaaggatcccttgaccattcccacattaatctgcataattcttttcgcttgagttggaacgccggcagttggctcaatatctacaacagtcaggtcatttgaagcagttggcaccgagagcccagtgacggaatgccacagctccattggtgagttgtagaagtgtggattggatagatagacacgtggattgccggcttggcatcgtgacaagtcgataagaccggcagggaggcagttttctggaaaaattaatattaaaatttaaatttaaatttacaatcgaattttttaaaataaaactctctctctctctctcaccaatttgcacagtagtattatcaaaatatcgcggcattccattcttattacaaaatgctcgattctgcggaagagcaggatcgtaaagatccaaaggtggtgcatatctccacgaaggaaccccattcacagcgacatcttttgtgtattccatttgaattgatctacatatttgcggcacaaatatcgtcaatctgtcttctcgtttcagcatcggactgaacaattgtccatcggttccgttaatcattcgtgcgtatttagtatcccatgttccttcgggcatttctgtcatattattccacgtgtataaatgaccgattttcgatggagatggcacgccagcatccacttcgtatattccgtctgttgttccattttgctgaagaaaaatcaatattttggaaggaaaaccgtgcggcatggttgcgcaaaatttggctccgcctatttttctgtgcggcaccttgcaaactcatatcttaccccataaaagaatccaactctccgctgaagagaattcgtttcgcagaggaattgaagaattttatttttacaaacgatatcgattatcgggtcttcgtatccgtcgaatagagcatcgcttacttttacctaaaatttcactattatattacggagagcacaaaattccgagaattgcgtattgcacaacatatttgacgcgcaaaatgtgaaatatctcgtagcgaaaactacagtaattctttaaatgagactgctggagagttgtcgatttacgggctcgaattgaaaaaaattcgagcccgtaaatcgacacaagcgctacagtagccattcaacgaattactgtagttttcgctgcgagatatttcatattttgcgcgtcaaatatgctgtccaatacgcattcttagaaaaaactataccgtaatatacggagcctcggagaccatttttagcactgactcaatagcaaatttgattcgaactccaaaaattgtcacatcagccgcgtcgatgagcttttgaaatacaatattcggaattgtaaccttcatatccaaatggcacgttggacaagaagcatttttgttgaaatgatataatttttgatttttatagaatactcgggtatcattgtcagca