Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:333E10   

TH:333E10RNAiTH:333E10
PCR_productTH:333E10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS K04G7.10 Source_evidenceePCR297WS150 Sequence/Annotation Release
K04G7.11 Source_evidenceePCR32WS150 Sequence/Annotation Release
Overlaps_Gene K04G7.10 Source_evidenceePCR425WS150 Sequence/Annotation Release
Chunk_score Abs_score383
Max_abs_score383K04G7.10
Specificity_index0.691
Rel_score1
Map_statusBest_ePCRIII71607347161271
K04G7.11 Source_evidenceePCR192WS150 Sequence/Annotation Release
Chunk_score Abs_score171
Specificity_index0.309
Rel_score0.446
Map_statusBottom50_percentile_ePCRIII71607347161271
Overlaps_transcript K04G7.10 Source_evidenceePCR425WS150 Sequence/Annotation Release
K04G7.11 Source_evidenceePCR192WS150 Sequence/Annotation Release
WB_DNA_textTH:333E10538cgaagctcttggattctcagctggattccacgtggcgattccttgttctactttatatgctaacaattcatctttttgtcgtcttttttcttcttttgcttcagcttttgttactactgggatttttgctggagtatctttcggatcctgaaaaaaaaatagcttccaaaataataaagttacgttcaaacctcaaataattgaatatattgagcaactccagtcatcggagcccttttagcatttttgtccactagtaggtcctggcatggtggaagatattgcactggtggtcgtgcttcgaaaagcgccagaagattgggaggtagaaatgccgtcatgtcacctgaaaataatttttatttattatttgagttttgtaggtacaaagattatcgaatagaagagagaaaatagtatggaatgggaagatgaagaacaaaacaaaagaagaaaaaaagttgaaaaaatgtctgaaaaagaaaataaaaaagcgatcctcggtttcagatagctgttccacgttccaaatcgtctt