Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:335c2   

TH:335c2RNAiTH:335c2
PCR_productTH:335c2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC38C10.4 Source_evidenceePCR318WS150 Sequence/Annotation Release
Overlaps_Gene C38C10.2 Source_evidenceePCR12WS150 Sequence/Annotation Release
C38C10.4 Source_evidenceePCR333WS150 Sequence/Annotation Release
Chunk_score Abs_score291
Max_abs_score291C38C10.4
Specificity_index0.579
Rel_score1
Map_statusUnique_ePCRIII93899949391674
F22B7.13 Chunk_score Abs_score212
Specificity_index0.421
Rel_score0.729
Overlaps_transcript C38C10.2.2 Source_evidenceePCR11WS150 Sequence/Annotation Release
C38C10.4 Source_evidenceePCR333WS150 Sequence/Annotation Release
C38C10.2.1 Source_evidenceePCR12WS150 Sequence/Annotation Release
WB_DNA_textTH:335c21681gactgacagcctgaaaacaaaaaatcagaaaattcaagtgataacaaaaataattgaaatatgttcctcgatcaaacatataatgtggtgaagaagataagaaatgcggcaacgtaaaggaagagccgcccaagcggcaggccaactcaagagctctcaggactaattgaaattcgttgaaaatcggatttcactacttggacaacaagagggtgaaactcagatgacgttgtttgagataactgcttctcgctaaaacagaataagaagaaaaaacagaaggcgcggtgagacacatgagaaacagagggcggttatttggagcacggctagcgcgcaaaagtgatgcaatgtgatgaagctggtagaaaaatggaataacagaaagggaattttataattggaaaaaatcaccatactttcgtgaaaatattaagagatttgtgtaaagtgcctgaccagttaataatatttacaatgttgggtaaagagcgtaggcataattcaaagagcaccgcctccaaattacatgttttcagtggaatcacgcgtttatatttacctaaaacaaattttcttttaagctgaccgattaccacacttcttatactccgaaatttcgtgtttctattgataagacggtcagcgaaaatgaccaaatatgatgggaagagcattttcccatcaagattctgatattttttgaaagaaaagtatttatagaaggaaaagactaacgcaattgaatgaaaaaataaagaaaagtgtgtcagagaaaagaaaaggtaacccgatacgacagttttaagaattgcaaactttacgccctccaatgtcggagatttgagcgttcaaaaaaattgttcacgtatttcaagtaatatcatatttagccgctcaaaagtatttttaataggagaaaaaacataaatcatttcgggtctaggtttcgcctaaaaactgaagaatacgaaaggatgcaggagaatggcgctcgttccctcggacgctggcagtctccatctctctgcgtctctttactttcgatatcttccggattccgaggtcactaaccatgagcttttgaaatgacgttgggagggcacgtggggaagttcagagagaataacaaagttctataaaagtatgacttgacggatatcgctaattgaaaaaaattagctttactgaccatcaaataaaataaaattataataaagaacaaccactaaaataataataacatttacttaaagaaagtaaaaaataaataaagtttgattgtattatttgacagaaaaaataatggtcctatttggacgtcattgtcacatcatcgcttcgagtatcatcgccctgtatcgaatttgtagaatccaatgacgatttgcttttcttcgacctcttcaggatcctattcattgtgtgaccatcgaacttcatcgactgcacttttgtccaattggcacggagtccagggagaattctgtggctctttgtagtctttttcgatgccgatgacactggacgagctggaaaaatataaatttgcatacatttacgcttatttgtaatatttcttacgcggaatgaatctggcagcagacagttcagttctctgatcatccatacgcgagctcatactgaaaatgagatccatcatgtctacgggttcctcgtt