Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:337D10   

TH:337D10RNAiTH:337D10
PCR_productTH:337D10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY56A3A.11 Source_evidenceePCR184WS150 Sequence/Annotation Release
Overlaps_Gene Y56A3A.11 Source_evidenceePCR184WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII1189655011897992
Y75B8A.18 Chunk_scoreAbs_score59
F36F12.4 Chunk_score (3)
Overlaps_transcriptY56A3A.11 Source_evidenceePCR184WS150 Sequence/Annotation Release
WB_DNA_textTH:337D101443gggccaaacttgaaaaatctcaactttttcgggcaattttttaatttttaaacaaattttcttaccggaaaagtcaaaaacgggaattatctcaaacaaaaaattcgaaaaaataacgaaaatgtttaatttagactaaactccctccaaatgagatctccccggccaatcagcgcctgcgaactccgcccactccatctgattggttgaaaagtgggcggagcgagtcgctgattggtcgggaagttctcattttggagggaatttagccaaaattttgatttttcgtgtttcttctgggattttttttgcgaaaaaaatgaaatcctaacccgcccactcattggcagcttgctcattgagctttccatttggctccccgcaactttgactgaagcatgatctactgacacctcgactctctttcctctcatccttcaaccactggccaattccagacatttcatggataattcgtgaagctgtctcatcaaatatctcgacaagtccaccattctggaaaaaatatcgattttttattgatttttttcaaaattattatagaggcgcagaaaaattcccgatttgaaatcgaaacgcgctctatcggcaatttccgcctccgatgcatgggtcccgctggggttttcacggagttctggcctttctcattgaatttttcgcggcgctccattggcaatcgcctgccggacaacgcgtgggaaagtcgtgtacttcacacggacaagtgcatttagttttacaatcgagccgcgacgcgacacgcaacgcgccgtaaatctaccccagatatggccgagccgaaatggtcgagttcggcaaactcttccatttaaatttatgagggaagccaaaaatcagtgattttggcggcaattcgccgtttttatagatttttatgctaaaataatgtaaaaaatcattaaaaactgtttgaattcacgattttgccgccaaaaacacaacgggacccaatttttccgcatcttcataatacgaaacccaccaaaaatgcatcaatcaggacaatcaggaggattgatgcatttttggtgggtttcgtattatggagacgcagaaaaattgggtcccgttgggtttttggcggcaaaatcgtgaattcaaatggtttttaacattattttagcataaaaatcaataagaacggcgaattgccgccaaaaacacggatttctggctttcctcataaattgaaatggaagagttttttgccgaactaggccattttggctcggccatatctggggtagatttacggcgcgttgcgtgtcgcgtcgcggctcgattgtaaaactaaatgtatttgtccgtgtggagtacacgcgctttcccacgcgttgtccgacagacgattgtcaatggagcgcgaaaaattccaggttttttcccatttttctgcgt