Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:337E4   

TH:337E4RNAiTH:337E4
PCR_productTH:337E4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC09E7.1 Source_evidenceePCR519WS150 Sequence/Annotation Release
Overlaps_Gene C09E7.1 Source_evidenceePCR519WS150 Sequence/Annotation Release
Chunk_score Abs_score456
Max_abs_score456C09E7.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII65329966533825
Overlaps_transcriptC09E7.1 Source_evidenceePCR519WS150 Sequence/Annotation Release
WB_DNA_textTH:337E4830aactccctgatggaagcctaaattttttgaattagtagtttgttctttttgaaatagttgttcattacaatcaatatgtttaagtgctttgtttccagatatgtgttttcatttccctgattattccttacatgtcatattgcccccttaatttcgactctagaaccaacatctttgtagctgcctgtgatccaaaccgtcatccggtaatcgttgattaaaattttcagttgaaattttcattcttgttcagataaccacgtttcaaaaccaatcaactgtattttttccggccattgctatgattgttaacatgagtattattttatggatgaagctattcaaaaagtcaactggagcaacttcttcaaaatgggaaaagacgatcattcgacaagcgatttctacagcaatttacttgtctatttatgaaattggttatcagtgtataaggcaatttccagtaagtttaaactaatttttattctattgagctaataatttcaggtagagtacgcgcgacttccactagaagcccgtactataattctacagtttcgtttttgtattgtgtgttctatcaattttcttgtatattttgtagaggcacgatcaaccagagagcttctcattggaaagatcaagtctagattttcagtgtcaaatggatcgaaaataactgtagtctcccgtatcccaacattttaagttttattttgtatcaataaatattttaatcaaatgtcaaagcttatgttagatgaaaatacaaagaatcactgcaagacaggataatcggtggggttcaggagtttctccttgcaagttgg