Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:338a7   

TH:338a7RNAiTH:338a7
PCR_productTH:338a7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y43F4B.5b Source_evidenceePCR87WS150 Sequence/Annotation Release
Y43F4B.6 Source_evidenceePCR452WS150 Sequence/Annotation Release
Overlaps_Gene Y43F4B.5 Source_evidenceePCR459WS150 Sequence/Annotation Release
Chunk_score Abs_score438
Specificity_index0.338
Rel_score0.512
Map_statusTop50_percentile_ePCRIII1330181813303378
Y43F4B.6 Source_evidenceePCR730WS150 Sequence/Annotation Release
Chunk_score Abs_score688
Max_abs_score688Y43F4B.6
Specificity_index0.662
Rel_score1
Map_statusBest_ePCRIII1330181813303378
Overlaps_transcript Y43F4B.5a.2 Source_evidenceePCR331WS150 Sequence/Annotation Release
Y43F4B.5b Source_evidenceePCR373WS150 Sequence/Annotation Release
Y43F4B.5a.1 Source_evidenceePCR459WS150 Sequence/Annotation Release
Y43F4B.6 Source_evidenceePCR730WS150 Sequence/Annotation Release
WB_DNA_textTH:338a71561gaagttcccgacgaaaatcggagaagccgaagtggcatccgtgagagacttgacgatcggatacgacaactcaaagcccgacaataagcccgttcttccactctcgacttcctcggaaatggtgactttcttccttaaaactggaagtgtcactactctccgagcatctggtactgagccaaaaatcaagtactatattgaactcatcactgctccgggaaaaacgcagaatgatctggaaagtgtgatttctgagatggatcaactcgagaaggatgtcgtcgctacacttttgagaccacagcaatttggactgattccaagaaaataaaaatttttgtcttgaataagaatcaaaaaatgtttataaatctatttgcattccgatatattgtagtcttcttctattgtgataattaatttttcaatttatttccccaataaattactgaacgttctaaaagctgtacgcaaaaccaaacgaagacattaaagtgtgtaaactttcaattttattgaagcattttgagaaaaaatggataagaaaaatgcctaataggtttacttaatttaaaatcatctatttaagacagaatggggggtcaaacgacacaatttagtacccgaatactattattcacagtaaaagttaattaatcattagttgacaggaggaggcattggtgtgttaaatatttttcacacacaaaacttggaatttagagcggtccaagatccgttcgacgactctttcgcttgatgggaggaacaccgtctgcttccgacgttggagctgcaccgatcacgaatgttgagttggaaggagacggttgcgaatcgtccaacacaatagtggcagaattgaacgaatctttgacgaaggtggcattgttcattgcctcgttttcaatgtcttcatcttcttctgttagacgggtatcatcgtcacatttgattggagacatcgccactcgtctgaaaataaaaatatattagcagttattaaccatttctgttggaagattcgcaacaagactctgtgatcagcttttaatttgtgatcatttccatcgagcatcacctgctctaacccaattcaactcgtcaattcaggatttaaaaaatcaaatgtaggcctcgcatctgacggaggaacgcaaaaaatttacgcgtacccgccttgtaaaggccagttaatgtcagaatgactcaatatgacattttcgtttaaaattttcacgaaaatgcactcaagagttcgttgattgggagagctggtgaatggctcacggtcagaccttttactatagtcatcatttcacaggaatctttttgaaaatgaatttacatttaaaaacgacaaaccttttgacattgtcatcagttgtccgattcatctcaacagccaacagggagtgatctttgcgcttttggtgtctcgagtcatccatggtcacatcctccgagttaacgacgtttccatagtacttgacagcacgacgagcacgttcattcctctggagctccggttttggtgtcaatcctcccatgaagtttgtcg