Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:340-f6   

TH:340-f6RNAiTH:340-f6
PCR_productTH:340-f6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSE01B7.1 Source_evidenceePCR508WS150 Sequence/Annotation Release
Overlaps_Gene E01B7.1 Source_evidenceePCR508WS150 Sequence/Annotation Release
Chunk_score Abs_score424
Max_abs_score424E01B7.1
Specificity_index0.633
Rel_score1
Map_statusUnique_ePCRV1792759217929328
E02H9.3 Chunk_score Abs_score246
Specificity_index0.367
Rel_score0.58
Overlaps_transcriptE01B7.1 Source_evidenceePCR508WS150 Sequence/Annotation Release
WB_DNA_textTH:340-f61737tgaactcatccggacttcaattcacaagtatgacggagcttcttgccacatgctcacttacagagcagcaaacacgacaatttgagcaaaaatcgcttgatgtgtatgtttttagcgtggaaattcggaaaaatcgattaaaatcatcgaaaactgggaaaaatcgattttccagtggaaaaattgaaaatctttaggtttttcactttaaaatcttaaaatatagtgcaaaactcgaaattttacgtagaaaactcgaaaaaattccgaattttatgataaattcagtaaaaaactcgaaaaattgagaaaatcccagttttaacagaaaaaaatcgaaaaaaccccaaatttccaaattttcagagtatatcaatctttgaaaaatttgcaaggatctgctgaaaaagcccgtggagatttggagcaacaataccgattattgatgaaagccggtgaactcggaaatattatcacgaaaagctcgaaatttgcgagatggaagcaaaatgttcgtgtgaaaatggaaaaatggcgaaaaaaacgtgtatttcggctggaaaatcgaaaaaaaaacgcaaaatttcatccaaaattcaattttttttccactaaaaacagtcaaaaaatcagattaattgcattttttcgatgaaaaacatgaaaaatatatgaaaaatggctgaaaatcagtttttaaagctgaaaagttgaaaaatggctgaaaaaacgagaattttgcggaaaaaaatcgaccaaaaccaaaaaacccatgaaaatgtgaaaatttcgttaaaaattcaattttttagccgaaatatcagcgaaaacccagaaatttcaagattttgaagcttttagcccaaaatttccaaaaaaaactccattaaaaatcgaaattttaaagaattttaccgaaaaatctcaaaaatctataaaaatcctattttcagacagcaaatgcggcacttttctatgcggatttcgagaaagtcgttcgagaagcttcaaatttgcaatctgtgctgaatattgtacgttttttcataaaaaatggaaaaaaaaaattaataaaactcgattttttcaggaaaaaacgcaaaaaaaaaatcgattttctcctgaaaattcaaaaaaaaactgttttttccaaaataaaaattcaataaaaatctattttcactctgaaaatccaaaaaatcaaaaaaatcctttttttttcagaaaaagcaaaagaaaaatcggttttaccgtaaaaattccgaaaaaatcaataaaatcgatttctttttcaggaaatattcaaaaaatcgatttccccttgaaaatttcaaaaaattttttaaaaaaatcgatttttaccccaaaaatcccgaaaaaaccaataaaaataaattttttaaagaaaaaaacgcaaaaaatcgacaaaaaacgattttctcctcatttctttaaaaattaaatttttttttcgaaaaatcgttaaaaattgatgattatcgatttttcatcgattttcatcctaaacccccagaaaaatcaataatttctttttcagaaatacgaaaatctggtccgacgtgctgacacacaaaaacgtgccgaacaagaggctgcggataaacgtgcggcgacgattactgtagattcgacgatgcgggcggttcgggcaaagatcacaccgcgggaacttgtacgaaaagtggaaaatgatacgccaaagaaaagcgcactgat