Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:340D6   

TH:340D6RNAiTH:340D6
PCR_productTH:340D6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C30C11.4 Source_evidenceePCR930WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII84446038445587
Overlaps_transcript C30C11.4.1 Source_evidenceePCR930WS150 Sequence/Annotation Release
C30C11.4.2 Source_evidenceePCR930WS150 Sequence/Annotation Release
WB_DNA_textTH:340D6985cgcgatatctttccacaacaggtgttcccactgctttgagctcggagagcctcttctcataaacatctcgttcggcatcttctccctcgtcgtaaagccaatcttcggtggaggtgagaacagaacggaactcgtcagcggcagccggggtgatgaattcagcatactgatcagacactttgtcacgcatttcgtaaacgtactcctcgagcgagttcttggcgtcagccttggccttttctctagcgtcagattcttgcatctgaagctcaaggttatggaacttttgaacatcgtaagagactggaatcgactcaataacttccaaatcaactggaacaagtttagtcttcttcactggttccagtggctcagcaggagcttcagttttagcgtctccatccacttccattgcctcagctggaacttcctcgacaattcttggttcatacattgtggcagaagcgatcgtgaagataccatctggattaacacgaaccttcaccttaaccttctgattaccaccatcggcacctggtcgtgctccattgactttccaagatccaatatgaacctggttatgtgggacaacgtttggttgagcgtaatgggcttcaacattgaagggaccacttcgaagaagtgagactagtttggagaatggaacctcgtctcggggcgagaagacgtcgttttctctgaaattaatatattcatgagaatcattttttacaccagaaaatcgacacttaccctccgttttctcctgtactgttccagctgagacgaatacgatatggctgagtatctttgatggcgaactcacgaacacggaaagtgggagaaagaattgcacattgcatggcagctccacgagcgacagcctcgtcttgattcatcgtggttttcggttcctttccgaaaagatccttgacaatctctctgatcatcggaattcttgaagatcctccgacaatttcgatct