Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:340E5   

TH:340E5RNAiTH:340E5
PCR_productTH:340E5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK03H1.2 Source_evidenceePCR1091WS150 Sequence/Annotation Release
Overlaps_Gene K03H1.2 (3)
Overlaps_transcriptK03H1.2 Source_evidenceePCR1091WS150 Sequence/Annotation Release
WB_DNA_textTH:340E51191tccgttttcgtactgcaacacttcctcttgctgctgaaacagccatatcacatgttgtatcaacaaccggaatgattggttgtgcttgtttagtgaaaacaattcgaccatcaaggaatggaggaacaatgttttgaacgagaattgtgacacgattctcatcagtttcatcttcaaaaatacttgataattcatcagccatcgcgacgactcctgatctatgcagtcgattgttctcccataactcattctctcttttgatcgcctgctgcttcactgtaagtctcggcttctgagttttctcctgccattgcttttctcgtttttccacaaattcgtcagaaaccttattgaatggattatactcatcatcaaatgctccttcattatcataccattctctgtccaaattcttctgttcctcttcccattgagctctctcttcgtcatcatgaaatgtgggctctgctttttcttctttaacacttcgtaccgaatcttctggttttcgatgtctccgtctcttctcatcatctctattccttctttcacttctccatgcacttgaaatgcttcgttccgaatccatatatcgttttctgtctctttcaccccgcggagtcggcatatcccaactatttcgttttctggaagatccttcacgatcatcttgatcccagctcattctggatggtgtatcgggaactttaaagcgaggagtctgatctccacttcgatctttccaacctcttctactactcggctctcttcgttctgatctgtcacggtctcgtctgcgatcatcatcccgacttttgtatttcattccacggtcgtcacgatctcgatgcttctcatgaactctgaaatcatcaatttacttcgctaatttaatgtttgaatcacttttcaattccttttcgaaccgattccgtgacacctcgatcgtcatcatcctcaagacgttttctggcgtgttcccgctttgtagacgccaatctatcgagcccaagcaagcttctgcaatttaaattgtttttatttgaagaaaattaaagtatatatttagttactcacttcccggatggttcggttggttttgaatctccctctacttttttctttttaataaccaatccaccaaatgtgtcactggttccttcgaggcggccatctgcccgtttatccgac