Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: TH:341D7-R   

TH:341D7-RSequenceCAAACTTGCACCTTCACACG
Length20
In_sequenceT20H4
PCR_productTH:341D7