Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: TH:341b2-R   

TH:341b2-RSequenceGCAACTGGAATAACGACAGTGA
Length22
In_sequencePAR2
PCR_productTH:341b2