Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:341f5   

TH:341f5RNAiTH:341f5
PCR_productTH:341f5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene ZK1010.1 Source_evidenceePCR355WS150 Sequence/Annotation Release
Chunk_score Abs_score292
Max_abs_score292ZK1010.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1297755612978036
Overlaps_transcript ZK1010.1.1 Source_evidenceePCR355WS150 Sequence/Annotation Release
ZK1010.1.2 Source_evidenceePCR355WS150 Sequence/Annotation Release
WB_DNA_textTH:341f5481ctggagtgtccgcacttcttctttctgcagttgctggcacgtggtgggagacgagcatagcactttctgcagatctgcttgtcgcagttgtacttctgggcgagctgacggagagatggctcgatgattcctgaatttagaaatatttctcaatgcctgaacattagaaaaaaactaacctccacgaagacggagcaccaagtggagagtagactccttttggatgttgtagtcggagagagtacgtccatcctcgagttgctttcctgaaattagaaaattatattgggtgttttgcccggaaattaattcaagaatatatcaggtctgaataataacgtaccggcgaagatcaatctttgctgatctggtgggattccctccttgtcttggatcttggccttgacattctcaatggtatcggaagcctcgacttcgagggtaatagtcttacccgtcagagtcttgacgaagatttgca