Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: WBPaper00024346:C36E8_2.1   

WBPaper00024346:C36E8_2.1RNAiWBRNAi00038545
PCR_productWBPaper00024346:C36E8_2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C36E8.5 Source_evidenceePCR927WS150 Sequence/Annotation Release
Chunk_score Abs_score843
Max_abs_score843C36E8.5
Specificity_index1
Rel_score1
Map_statusTop85_percentile_ePCRIII40163264017329
Overlaps_transcript C36E8.5.1 Source_evidenceePCR927WS150 Sequence/Annotation Release
C36E8.5.3 Source_evidenceePCR927WS150 Sequence/Annotation Release
C36E8.5.2 Source_evidenceePCR927WS150 Sequence/Annotation Release
WB_DNA_textWBPaper00024346:C36E8_2.11004gatagcggtcgagtttccaacgaaggtggcagccatcttgagtcctcttggtgggatgtcacaaacggcggtcttgacgttgttcgggatccattcgacgaagtaggacgagttcttgttctgaacgttgagcatttgctcgtcaacctctctcatcgacatgcgtccacggaacatagcggccacggtcaggtaacgtccgtgtcttgggtcacaggcagccatcatgttcttggcatcgaacatttgttgggtgagctcggcgacggtaagggcacggtaagcctgggttcccttggcggaaagtggtgcgaatcctggcatgaagaagtgaagacgtgggaatggaaccatgttgacggcaagcttgcggagatcggcattgagctgtcctgggaatcggagacaggtggtaactccggacatggtgagggatactgaaaattgtaattattaggtttcaatttgggtaacttgtgcataacttaaacttgaacaagaaataataacttaccaagatggttcaaatcaccgtaggttgggttggtgagtttgagggtacggtagcagatgtcgtagagggcctcgttgtcaatgcagtaggtctcatcggtgttctcaacaagctggtggacggagagggtggcattgtatggttctacaactgtgtcggacacctttggcgatggtacaaccgagaatgagctcatgattctgtctgggtactcttcgcggattttggagatgagaagtgttcccattccagatccggttcctcctccgagagagtgagtgagttggaatccttgaagacaatcgcatccttcggcttccttgcggatcacgtcaagcacattgtcgacaagctcagctccttctgtgtagtgacccttggcccagttgtttccggctccgctttgtccgaacacaaagttgtcaggacggaacagctggccgaatggtccagagcggacagaatccatggttcctggttcgagatcgac