Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:102-h1_T7   

cenix:102-h1_T7SequenceCATGTTGTTCGACGGTTTTG
Length20
In_sequenceY62E10A
PCR_productcenix:102-h1