Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:108-a1_T3   

cenix:108-a1_T3SequenceCCTCCGAAGTTCAGCTCTTG
Length20
In_sequenceF28F8
PCR_productcenix:108-a1