Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:11-c12_T7   

cenix:11-c12_T7SequenceTTGGGGATACAAGTATCGGG
Length20
In_sequenceF28F8
PCR_productcenix:11-c12