Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:11-d1_T7   

cenix:11-d1_T7SequenceAATGCCTTCATGGAATCAGC
Length20
In_sequenceF23B12
PCR_productcenix:11-d1