Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:12-g9_T7   

cenix:12-g9_T7SequenceCTGGAAATGACTCGCTGACA
Length20
In_sequenceF26B1
PCR_productcenix:12-g9