Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:21-e8_T7   

cenix:21-e8_T7SequenceTCGACGCATGTATGTTGTGA
Length20
In_sequenceC47E12
PCR_productcenix:21-e8