Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:215-f11_T3   

cenix:215-f11_T3SequenceAGTCAAACAACGGTGGCAAT
Length20
In_sequenceY75B12B
PCR_productcenix:215-f11