Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:218-a7_T3   

cenix:218-a7_T3SequenceTTTCTCTGGAAAGGACCCAA
Length20
In_sequenceC06E7
PCR_productcenix:218-a7