Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:233-f1_T3   

cenix:233-f1_T3SequenceTGTGTTCTTTCAGGTTGACGA
Length21
In_sequenceY62E10A
PCR_productcenix:233-f1