Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:246-a8_T7   

cenix:246-a8_T7SequenceTTAGGTTTCAAATGGGCACC
Length20
In_sequenceF26B1
PCR_productcenix:246-a8