Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:306-e4_T7   

cenix:306-e4_T7SequenceTTTTACTCTTTGGGGGTTTTTGT
Length23
In_sequencePAR2
PCR_productcenix:306-e4