Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:312-h2_T3   

cenix:312-h2_T3SequenceGGCAGCGTTTATATGTTTACTCG
Length23
In_sequencePAR2
PCR_productcenix:312-h2