Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:321-d1_T3   

cenix:321-d1_T3SequenceAATTTTAGCATCCGTGGCAG
Length20
In_sequenceM01F1
PCR_productcenix:321-d1