Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:36-c2_T3   

cenix:36-c2_T3SequenceCCTGTTTGCACGTTGAAGAA
Length20
In_sequenceC47E12
PCR_productcenix:36-c2