Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:49-a11_T7   

cenix:49-a11_T7SequenceGCATAGTCGCCTTGCTTACC
Length20
In_sequenceF28F8
PCR_productcenix:49-a11