Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:53-b9_T7   

cenix:53-b9_T7SequenceGCACCAAAGAGACACAAGCA
Length20
In_sequenceF28F8
PCR_productcenix:53-b9