Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:63-b10_T7   

cenix:63-b10_T7SequenceTCTCCGCAACACATTTCAAG
Length20
In_sequenceY75B12B
PCR_productcenix:63-b10