Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:72-d1_T3   

cenix:72-d1_T3SequenceAGTAATACACAGGCGGCACC
Length20
In_sequenceF53F10
PCR_productcenix:72-d1