Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:77-e3_T3   

cenix:77-e3_T3SequenceACGACCCACAGAAGGACAAG
Length20
In_sequenceY71F9AL
PCR_productcenix:77-e3