Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_AAD39815_b   

mv_AAD39815_bSequenceACCAAGCCTGCGGTGATGGA
Length20
PCR_productmv_AAD39815