Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_D1054.15_b   

mv_D1054.15_bSequenceAGTACGCCTTCTTTTTGACAATTT
Length24
PCR_productmv_D1054.15