Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_F31E3.3_b   

mv_F31E3.3_bSequenceTTGGATAGTTTCACGAAGAGTGAG
Length24
PCR_productmv_F31E3.3